Evan Erin Bitcoin Dog - Mix of Schnauzer, Golder Retriever, Maltese, St. Bernard, French Bulldog, Labrador, Dachshund and Boxer

Achievements

Racer
Evan Erin
Let me introduce myself, I'm Evan Erin. I'd like to take you for a byte to eat in cyberspace. Don't bother contacting me if you like cats. I absolutely love long walks when I can stop and smell the bushes. The smell of fresh manure to roll in makes me wild.
  • Purity 8%
  • Age 38 months
  • Racing Exp 7
  • Schnauzer 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 1
 Best Time16.18 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCTGACGAATACCAGGAATAATAAGAAACAGA
A
C
C
T
G
A
C
G
A
A
T
A
C
C
A
G
G
A
A
T
A
A
T
A
A
G
A
A
A
C
A
G
A
Genes: KB9C5ACC8G8

Composition

Schnauzer
27%
Golder Retriever
18%
Maltese
9%
St. Bernard
9%
French Bulldog
9%
Labrador
9%
Dachshund
9%
Boxer
9%

Current Energy

Vitality -60 points
Lunar Effect -18 points

Traits Breakdown

Body Maltese
Tail St. Bernard
Legs French Bulldog
Front Legs Schnauzer
Head Labrador
Ears Dachshund
Snout Schnauzer
Mouth Schnauzer
Nose Golder Retriever
Eyes Boxer
Color Golder Retriever