Viva Volvo Crypto Dog - Mix of Boxer, German Shepard, Rottweiler, Yorkshire Terrier, Husky, Labrador and Schnauzer

Achievements

None
Viva Volvo
I'm having some new data architecture built for me, then I'd like to have you over to my place. I hate not being allowed to hunt treasure in the garbage. It smells so good! I'm a serial monogamist. I enjoy destroying a nice fresh pair of slippers. I just want a snuggle buddy with a nice, soft coat.
  • Purity 11%
  • Age 3 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTCATCATTAAACCACACACCAATACACAAC
A
A
C
T
C
A
T
C
A
T
T
A
A
A
C
C
A
C
A
C
A
C
C
A
A
T
A
C
A
C
A
A
C
Genes: G77FGH45CHG

Composition

Boxer
27%
German Shepard
18%
Rottweiler
18%
Yorkshire Terrier
9%
Husky
9%
Labrador
9%
Schnauzer
9%

Current Energy

Vitality -32 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail German Shepard
Legs German Shepard
Front Legs Yorkshire Terrier
Head Boxer
Ears Rottweiler
Snout Husky
Mouth Labrador
Nose Schnauzer
Eyes Rottweiler
Color Boxer