Mila Mansell Digital Cryptocurrency Dog - Mix of Pug, Shiba Inu, Corgi, Schnauzer, Boxer, French Bulldog, Grey Wolf, Maltese and Border Collie

Achievements

Racer
Mila Mansell
How's it going? I'm Mila Mansell. Baby, I'm made from the same stuff as dreams. My favorite sport is catching treats my human throws! My humans should try spending 8 hours a day in a crate! I love unconditionally. I never met a crotch or a butt I didn't like, but I'm just friendly that way.
  • Purity 4%
  • Age 39 months
  • Racing Exp 9
  • Pug 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 0
 Best Time17.13 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAAGCATAAACGAACGAGAACCCACCGAATAC
G
T
A
A
G
C
A
T
A
A
A
C
G
A
A
C
G
A
G
A
A
C
C
C
A
C
C
G
A
A
T
A
C
Genes: EOCG292LK2J

Composition

Pug
27%
Shiba Inu
9%
Corgi
9%
Schnauzer
9%
Boxer
9%
French Bulldog
9%
Grey Wolf
9%
Maltese
9%
Border Collie
9%

Current Energy

Vitality -61 points
Lunar Effect -8 points

Traits Breakdown

Body Shiba Inu
Tail Corgi
Legs Schnauzer
Front Legs Boxer
Head Pug
Ears French Bulldog
Snout Pug
Mouth Grey Wolf
Nose Maltese
Eyes Pug
Color Border Collie

Parents

Children

Photos

online doggy race photo crypto dog racing podium virtual pet racing online dog racing Bitcoin doggy racing Litecoin doggy race podium cryptocurrency pet race Bitcoin pet racing photo