Mila Mansell Digital Cryptocurrency Dog - Mix of Pug, Shiba Inu, Corgi, Schnauzer, Boxer, French Bulldog, Grey Wolf, Maltese and Border Collie
Mila Mansell
  • Purity 4%
  • Age 72 months
  • Racing Exp 9
  • Pug 27%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

How's it going? I'm Mila Mansell. Baby, I'm made from the same stuff as dreams. My favorite sport is catching treats my human throws! My humans should try spending 8 hours a day in a crate! I love unconditionally. I never met a crotch or a butt I didn't like, but I'm just friendly that way.

Racing Stats

Ran 2 races
  • 1 0 0
 Best Time17.13 sec
No rank  RacingĀ *** Pts
50.0% wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GTAAGCATAAACGAACGAGAACCCACCGAATAC
G
T
A
A
G
C
A
T
A
A
A
C
G
A
A
C
G
A
G
A
A
C
C
C
A
C
C
G
A
A
T
A
C
Genes: EOCG292LK2J

Composition

Pug
27%
Shiba Inu
9%
Corgi
9%
Schnauzer
9%
Boxer
9%
French Bulldog
9%
Grey Wolf
9%
Maltese
9%
Border Collie
9%

Current Energy

Vitality -61 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Corgi
Legs Schnauzer
Front Legs Boxer
Head Pug
Ears French Bulldog
Snout Pug
Mouth Grey Wolf
Nose Maltese
Eyes Pug
Color Border Collie

Parents

No Children

Photos

crypto dog race podium Bitcoin doggy racing photo crypto canine race podium Bitcoin dog race online dog race online dog race virtual dog racing podium crypto doggy race
Gift