Snoopy Sophie Litecoin Game Dog - Mix of Husky, Corgi, Schnauzer, Grey Wolf, Boxer, St. Bernard, Maltese, Rottweiler, Golder Retriever and German Shepard

Achievements

None
Snoopy Sophie
I enjoy exploration and am game for anything doggy-style. Oh, go ahead. Pet me. I know you want to. Squeaky toys are the best, don't you agree? Peanut butter is delish but I HATE when it sticks to the roof of my mouth. If you are looking for a pooch who's in touch with feelings, here I am.
  • Purity 1%
  • Age 42 months
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCACAATACCCAACTGAACCCACAGATCAACA
A
G
C
A
C
A
A
T
A
C
C
C
A
A
C
T
G
A
A
C
C
C
A
C
A
G
A
T
C
A
A
C
A
Genes: O4CLGBKH874

Composition

Husky
18%
Corgi
9%
Schnauzer
9%
Grey Wolf
9%
Boxer
9%
St. Bernard
9%
Maltese
9%
Rottweiler
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -40 points
Lunar Effect +4 points

Traits Breakdown

Body Corgi
Tail Husky
Legs Schnauzer
Front Legs Grey Wolf
Head Boxer
Ears St. Bernard
Snout Maltese
Mouth Rottweiler
Nose Golder Retriever
Eyes German Shepard
Color Husky