Snoopy Sophie Litecoin Game Dog - Mix of Husky, Corgi, Schnauzer, Grey Wolf, Boxer, St. Bernard, Maltese, Rottweiler, Golder Retriever and German Shepard
Snoopy Sophie
  • Purity 1%
  • Age 72 months
  • Racing Exp 7
  • Husky 18%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

I enjoy exploration and am game for anything doggy-style. Oh, go ahead. Pet me. I know you want to. Squeaky toys are the best, don't you agree? Peanut butter is delish but I HATE when it sticks to the roof of my mouth. If you are looking for a pooch who's in touch with feelings, here I am.

Racing Stats

Ran 2 races
  • 0 0 1
 Best Time17.90 sec
No rank  RacingĀ *** Pts
50.0% wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGCACAATACCCAACTGAACCCACAGATCAACA
A
G
C
A
C
A
A
T
A
C
C
C
A
A
C
T
G
A
A
C
C
C
A
C
A
G
A
T
C
A
A
C
A
Genes: O4CLGBKH874

Composition

Husky
18%
Corgi
9%
Schnauzer
9%
Grey Wolf
9%
Boxer
9%
St. Bernard
9%
Maltese
9%
Rottweiler
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -40 points
Lunar Effect -4 points

Traits Breakdown

Body Corgi
Tail Husky
Legs Schnauzer
Front Legs Grey Wolf
Head Boxer
Ears St. Bernard
Snout Maltese
Mouth Rottweiler
Nose Golder Retriever
Eyes German Shepard
Color Husky

Parents

No Children

Photos

Bitcoin doggy race Bitcoin dog race results cryptocurrency pet race photo Bitcoin dog racing podium cryptocurrency dog race photo online doggy race photo virtual dog racing virtual canine racing
Gift