Rookie Road Game Bitcoin Game Dog - Mix of Grey Wolf, Husky, Labrador, Pitbull terrier, German Shepard, Poodle and Corgi

Achievements

None
Rookie Road Game
Hey there... I'm Rookie Road Game. I'd like to take you for a byte to eat in cyberspace. Spiked dog collars really turn me on. Don't bother contacting me if you like cats. Let me have a pig's ear and I'm in heaven. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 18%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 45%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACCACCCTCCTCACCCGACCCCCCCCCCAGC
A
C
A
C
C
A
C
C
C
T
C
C
T
C
A
C
C
C
G
A
C
C
C
C
C
C
C
C
C
C
A
G
C
Genes: 45LN7LILLLO

Composition

Grey Wolf
45%
Husky
9%
Labrador
9%
Pitbull terrier
9%
German Shepard
9%
Poodle
9%
Corgi
9%

Current Energy

Vitality -24 points
Lunar Effect -16 points

Traits Breakdown

Body Husky
Tail Labrador
Legs Grey Wolf
Front Legs Pitbull terrier
Head German Shepard
Ears Grey Wolf
Snout Poodle
Mouth Grey Wolf
Nose Grey Wolf
Eyes Grey Wolf
Color Corgi