Cassis Cyrano Litecoin Dog - Mix of Grey Wolf, Husky, Pitbull terrier, Beagle, Poodle and Corgi

Achievements

None
Cassis Cyrano
I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I believe running along the beach to catch a stick can be nearly orgasmic. I've been known to run with bad dogs. I'm into chasing fast cars, squirrels and my tail.
  • Purity 25%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 55%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCACACCCTCCCTACCCGACCCCCCCCCCAGC
C
C
C
A
C
A
C
C
C
T
C
C
C
T
A
C
C
C
G
A
C
C
C
C
C
C
C
C
C
C
A
G
C
Genes: L4LNDLILLLO

Composition

Grey Wolf
55%
Husky
9%
Pitbull terrier
9%
Beagle
9%
Poodle
9%
Corgi
9%

Current Energy

Vitality -31 points
Lunar Effect -22 points

Traits Breakdown

Body Grey Wolf
Tail Husky
Legs Grey Wolf
Front Legs Pitbull terrier
Head Beagle
Ears Grey Wolf
Snout Poodle
Mouth Grey Wolf
Nose Grey Wolf
Eyes Grey Wolf
Color Corgi