Shadow Speedo Digital Cryptocurrency Dog - Mix of Rottweiler, Pug, St. Bernard, Grey Wolf, German Shepard, Dachshund, Yorkshire Terrier, French Bulldog, Poodle and Schnauzer

Achievements

Pro Racer
Shadow Speedo
Wassup? Yo, call me Shadow Speedo. My humans say I bark too much, but I have a lot to say! If you have fleas or ticks, don't bother. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I like never worrying about my dog poo. I've got people for that.
  • Purity 1%
  • Age 39 months
  • Racing Exp 73
  • Rottweiler 18%
  • 13 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

13 races   |
  • 6 3 0
 Best Time15.50 sec
No rank  Racing *** Pts
69.2 % wins (9) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAATGACACCCCTCAGGATTACACCGAGACATA
G
A
A
T
G
A
C
A
C
C
C
C
T
C
A
G
G
A
T
T
A
C
A
C
C
G
A
G
A
C
A
T
A
Genes: 2BHL7AFH9IC

Composition

Rottweiler
18%
Pug
9%
St. Bernard
9%
Grey Wolf
9%
German Shepard
9%
Dachshund
9%
Yorkshire Terrier
9%
French Bulldog
9%
Poodle
9%
Schnauzer
9%

Current Energy

Vitality -23 points
Lunar Effect -8 points

Traits Breakdown

Body Pug
Tail St. Bernard
Legs Rottweiler
Front Legs Grey Wolf
Head German Shepard
Ears Dachshund
Snout Yorkshire Terrier
Mouth Rottweiler
Nose French Bulldog
Eyes Poodle
Color Schnauzer