Joan Of Arc Justice Bitcoin Game Dog - Mix of German Shepard, Golder Retriever, French Bulldog, Border Collie, Rottweiler, St. Bernard and Schnauzer

Achievements

Podium Champion
Pro Racer
Master Champion
Joan Of Arc Justice
I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. My favorite treat is to steal the pepperoni off of pizza. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! Looking for that special tail wag.
  • Purity 14%
  • Age 2 months
  • Racing Exp 86
  • German Shepard 36%
  • 17 races
  • Gen 14
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 5 4 2
17 races    Best Time14.75 sec
No rank  Racing *** Coins
64.7 % wins (11) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACGATACTCACACTGAAGAAGATCATCAATA
T
C
A
C
G
A
T
A
C
T
C
A
C
A
C
T
G
A
A
G
A
A
G
A
T
C
A
T
C
A
A
T
A
Genes: 79J7HB8877C

Composition

German Shepard
36%
Golder Retriever
18%
French Bulldog
9%
Border Collie
9%
Rottweiler
9%
St. Bernard
9%
Schnauzer
9%

Current Energy

Vitality +21 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail French Bulldog
Legs Border Collie
Front Legs German Shepard
Head Rottweiler
Ears St. Bernard
Snout Golder Retriever
Mouth Golder Retriever
Nose German Shepard
Eyes German Shepard
Color Schnauzer