Mango Motaro Cryptocurrency Game Dog - Mix of French Bulldog and Golder Retriever

Achievements

None
Mango Motaro
Good day to you! I'm Mango Motaro! I'm all about a hard drive because you can't do anything with a floppy disc. They say my bite is worse than my bark. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I just want to "share a bone"... ;)
  • Purity 70%
  • Age 5 months
  • Racing Exp 0
  • French Bulldog 82%
  • 0 races
  • Gen 12
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGACGACGACGACGAAGAAGACGACGACGACGA
C
G
A
C
G
A
C
G
A
C
G
A
C
G
A
A
G
A
A
G
A
C
G
A
C
G
A
C
G
A
C
G
A
Genes: 99999889999

Composition

French Bulldog
82%
Golder Retriever
18%

Current Energy

Vitality -41 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Golder Retriever
Snout Golder Retriever
Mouth French Bulldog
Nose French Bulldog
Eyes French Bulldog
Color French Bulldog