Field Goal Frou-Frou Bitcoin Dog - Mix of Pug, Shiba Inu, Maltese and Labrador

Achievements

None
Field Goal Frou-Frou
Sup? ;-) I'm Field Goal Frou-Frou. Halloween costumes are the worst, I hate 'em! I may need de-worming. My favorite position is doggie style ;) I'm looking for someone to share my big bed with, and who doesn't mind sharing with my human sometimes too ( He THINKS it's his).
  • Purity 52%
  • Age 3 months
  • Racing Exp 0
  • Pug 73%
  • 0 races
  • Gen 3
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAAGTAACCGAAGAAGAACCAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
A
C
C
G
A
A
G
A
A
G
A
A
C
C
A
G
A
A
G
A
A
Genes: 222EK222522

Composition

Pug
73%
Shiba Inu
9%
Maltese
9%
Labrador
9%

Current Energy

Vitality -53 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Maltese
Ears Pug
Snout Pug
Mouth Pug
Nose Labrador
Eyes Pug
Color Pug