Meta Knight Mercy Crypto Dog - Mix of Pitbull terrier, St. Bernard, Boxer, Poodle, Dachshund, Labrador BK, Pug, German Shepard and Golder Retriever
Meta Knight Mercy
  • Purity 3%
  • Age 37 months
  • Racing Exp 52
  • Pitbull terrier 18%
  • Gold medal 1 Silver medal 2 Bronze medal 4
  • 13 races
  • Gen 0
Ecstatic & Fast

Achievements

Podium Champion
Pro Racer

Bio

Hello there, my name is Meta Knight Mercy. I am a guard dog for the data warehouse. I like shaking my fur next to humans right after a good swim! I love car rides when I can stick my head out the window. I need laid otherwise I'm going to start agreeing with Grumpy Cat.

Racing Stats

Ran 13 races
  • 1 2 4
 Best Time16.13 sec
No rank  RacingĀ *** Pts
53.8 % wins (7) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AACGACTCCGGATGAGCAGAATGATCCTCAAGA
A
A
C
G
A
C
T
C
C
G
G
A
T
G
A
G
C
A
G
A
A
T
G
A
T
C
C
T
C
A
A
G
A
Genes: GINAB62BN78

Composition

Pitbull terrier
18%
St. Bernard
18%
Boxer
9%
Poodle
9%
Dachshund
9%
Labrador BK
9%
Pug
9%
German Shepard
9%
Golder Retriever
9%

Current Energy

Vitality -50 points
Lunar Effect +4 points

Traits Breakdown

Body Boxer
Tail Poodle
Legs Pitbull terrier
Front Legs Dachshund
Head St. Bernard
Ears Labrador BK
Snout Pug
Mouth St. Bernard
Nose Pitbull terrier
Eyes German Shepard
Color Golder Retriever

Parents

No Children

Photos

cryptocurrency dog race photo online pet race photo virtual pet racing podium cryptocurrency pet race crypto dog race Litecoin dog race photo Bitcoin dog racing cryptocurrency doggy racing podium
Gift