Meta Knight Mercy Crypto Dog - Mix of Pitbull terrier, St. Bernard, Boxer, Poodle, Dachshund, Labrador BK, Pug, German Shepard and Golder Retriever

Achievements

Racer
Meta Knight Mercy
Hello there, my name is Meta Knight Mercy. I am a guard dog for the data warehouse. I like shaking my fur next to humans right after a good swim! I love car rides when I can stick my head out the window. I need laid otherwise I'm going to start agreeing with Grumpy Cat.
  • Purity 3%
  • Age 41 months
  • Racing Exp 43
  • Pitbull terrier 18%
  • 11 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 2 4
11 races    Best Time15.28 sec
No rank  Racing *** Coins
54.5 % wins (6) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACGACTCCGGATGAGCAGAATGATCCTCAAGA
A
A
C
G
A
C
T
C
C
G
G
A
T
G
A
G
C
A
G
A
A
T
G
A
T
C
C
T
C
A
A
G
A
Genes: GINAB62BN78

Composition

Pitbull terrier
18%
St. Bernard
18%
Boxer
9%
Poodle
9%
Dachshund
9%
Labrador BK
9%
Pug
9%
German Shepard
9%
Golder Retriever
9%

Current Energy

Vitality -50 points
Lunar Effect -2 points

Traits Breakdown

Body Boxer
Tail Poodle
Legs Pitbull terrier
Front Legs Dachshund
Head St. Bernard
Ears Labrador BK
Snout Pug
Mouth St. Bernard
Nose Pitbull terrier
Eyes German Shepard
Color Golder Retriever