Barkley Blizzard Crypto Dog - Mix of Labrador, Golder Retriever, Husky, Maltese and Pitbull terrier

Achievements

None
Barkley Blizzard
How's it going? I'm Barkley Blizzard. I'd like to take you for a byte to eat in cyberspace. I've always had a crush on Lassie. I like never worrying about my dog poo. I've got people for that. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from??
  • Purity 40%
  • Age 2 months
  • Racing Exp 0
  • Labrador 64%
  • 0 races
  • Gen 19
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACCACCACCACCAAGACCACCAACAACCTCC
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
A
G
A
C
C
A
C
C
A
A
C
A
A
C
C
T
C
C
Genes: 555558554KN

Composition

Labrador
64%
Golder Retriever
9%
Husky
9%
Maltese
9%
Pitbull terrier
9%

Current Energy

Vitality +5 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Labrador
Front Legs Labrador
Head Labrador
Ears Golder Retriever
Snout Labrador
Mouth Labrador
Nose Husky
Eyes Maltese
Color Pitbull terrier