Ivan Ivy Cryptocurrency Game Dog - Mix of Corgi, Grey Wolf, Beagle, Yorkshire Terrier, St. Bernard, Pug, Golder Retriever, Labrador and Labrador BK

Achievements

Racer
Ivan Ivy
Ima cyber dog. My favorite way to relax is to be scratched on my belly. Shy dogs that tuck tail bore me. As a perfectionist, I have to find just the right 'spot'. I never knew my father.
  • Purity 3%
  • Age 41 months
  • Racing Exp 15
  • Corgi 18%
  • 2 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 0
2 races    Best Time15.83 sec
No rank  Racing *** Coins
100.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAAGCTTATGACCCGAAAGCAGACCAGCACCC
C
T
A
A
G
C
T
T
A
T
G
A
C
C
C
G
A
A
A
G
C
A
G
A
C
C
A
G
C
A
C
C
C
Genes: DOFBL2O856L

Composition

Corgi
18%
Grey Wolf
18%
Beagle
9%
Yorkshire Terrier
9%
St. Bernard
9%
Pug
9%
Golder Retriever
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -50 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Corgi
Legs Yorkshire Terrier
Front Legs St. Bernard
Head Grey Wolf
Ears Pug
Snout Corgi
Mouth Golder Retriever
Nose Labrador
Eyes Labrador BK
Color Grey Wolf

Parents

No Children

Photos

online pet racing photo crypto dog racing results