Govenor Greta Crypto Dog - Mix of Grey Wolf, Corgi, Husky and Labrador BK

Achievements

None
Govenor Greta
I'm not into dog collars, unless you're into S & M. I love fetching anything my human throws! My humans say I slobber too much, but hey, I'm just juicy. My favorite song is "Who Let the Dogs Out?" It was me :)
  • Purity 21%
  • Age 39 months
  • Racing Exp 0
  • Grey Wolf 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCAGCAGCCCCCCCACACCCGCAACAAGCACA
C
C
C
A
G
C
A
G
C
C
C
C
C
C
C
A
C
A
C
C
C
G
C
A
A
C
A
A
G
C
A
C
A
Genes: LOOLL4L64O4

Composition

Grey Wolf
36%
Corgi
27%
Husky
27%
Labrador BK
9%

Current Energy

Vitality -15 points
Lunar Effect -10 points

Traits Breakdown

Body Grey Wolf
Tail Corgi
Legs Corgi
Front Legs Grey Wolf
Head Grey Wolf
Ears Husky
Snout Grey Wolf
Mouth Labrador BK
Nose Husky
Eyes Corgi
Color Husky

Parents

No Children