Uggie Uhura Litecoin Dog - Mix of Labrador, Dachshund, Pug, Boxer, Beagle, Schnauzer, Husky, Maltese, Grey Wolf and Labrador BK

Achievements

None
Uggie Uhura
I don't like it when my bowl is empty, so I take it to my human and it magically refills! I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I adore sleeping upside down with my tongue hanging out! Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 1%
  • Age 41 months
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGACCAGAACCAAACCTAATAACAACCCCCGCA
G
G
A
C
C
A
G
A
A
C
C
A
A
A
C
C
T
A
A
T
A
A
C
A
A
C
C
C
C
C
G
C
A
Genes: A525GDC4KL6

Composition

Labrador
18%
Dachshund
9%
Pug
9%
Boxer
9%
Beagle
9%
Schnauzer
9%
Husky
9%
Maltese
9%
Grey Wolf
9%
Labrador BK
9%

Current Energy

Vitality -53 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Labrador
Legs Pug
Front Legs Labrador
Head Boxer
Ears Beagle
Snout Schnauzer
Mouth Husky
Nose Maltese
Eyes Grey Wolf
Color Labrador BK