Bentley Belle Bitcoin Dog - Mix of Grey Wolf, Shiba Inu, Labrador, Pug, Golder Retriever, Maltese, St. Bernard, Pitbull terrier, Yorkshire Terrier and Schnauzer

Achievements

Podium Champion
Pro Racer
Bentley Belle
What's up, dog? I'm Bentley Belle! If I can't reach it to clean it myself, it doesn't need cleaning! Air Bud is definitely my favorite movie. What a role model! When I can break free, I enjoy exploring my neighborhood without my human. I'd like to find a dawg to hang with, no pressure. We can always make puppies later.
  • Purity 1%
  • Age 39 months
  • Racing Exp 59
  • Grey Wolf 18%
  • 16 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

16 races   |
  • 3 2 2
 Best Time15.53 sec
No rank  Racing *** Pts
43.8 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTACCCCCACCCGAAAGAACCTGATCCTTAATA
G
T
A
C
C
C
C
C
A
C
C
C
G
A
A
A
G
A
A
C
C
T
G
A
T
C
C
T
T
A
A
T
A
Genes: EL5L28KBNFC

Composition

Grey Wolf
18%
Shiba Inu
9%
Labrador
9%
Pug
9%
Golder Retriever
9%
Maltese
9%
St. Bernard
9%
Pitbull terrier
9%
Yorkshire Terrier
9%
Schnauzer
9%

Current Energy

Vitality -23 points
Lunar Effect +2 points

Traits Breakdown

Body Shiba Inu
Tail Grey Wolf
Legs Labrador
Front Legs Grey Wolf
Head Pug
Ears Golder Retriever
Snout Maltese
Mouth St. Bernard
Nose Pitbull terrier
Eyes Yorkshire Terrier
Color Schnauzer