Bobo Bean Bitcoin Dog - Mix of Poodle, Pug, Rottweiler, Boxer, Golder Retriever, Labrador, Maltese, German Shepard and Husky

Achievements

Racer
Podium Champion
Bobo Bean
I'm Bobo Bean. How goes it? I don't appreciate being around bores who bark too much. My favorite song is "Who Let the Dogs Out?" It was me :) I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 3%
  • Age 43 months
  • Racing Exp 36
  • Poodle 18%
  • 11 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

11 races   |
  • 2 1 1
 Best Time15.62 sec
No rank  Racing *** Coins
36.4 % wins (4) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGACAACAGACCAGAAACCGACGAATCAACA
C
A
C
G
A
C
A
A
C
A
G
A
C
C
A
G
A
A
A
C
C
G
A
C
G
A
A
T
C
A
A
C
A
Genes: HIG852KI274

Composition

Poodle
18%
Pug
18%
Rottweiler
9%
Boxer
9%
Golder Retriever
9%
Labrador
9%
Maltese
9%
German Shepard
9%
Husky
9%

Current Energy

Vitality -42 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Poodle
Legs Boxer
Front Legs Golder Retriever
Head Labrador
Ears Pug
Snout Maltese
Mouth Poodle
Nose Pug
Eyes German Shepard
Color Husky