Molly Mister Miyagi Crypto Game Dog - Mix of Poodle, Pitbull terrier, French Bulldog, Shiba Inu, Golder Retriever, Labrador BK, Maltese, Beagle, Yorkshire Terrier and Schnauzer

Achievements

None
Molly Mister Miyagi
I live in cyberspace where you can turn me on. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! Chasing anything that will run is so much fun, I could do that all day. If we can run as a pack for a while, I'm open to that.
  • Purity 1%
  • Age 39 months
  • Racing Exp 0
  • Poodle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCCGAGTAGACAGAGCAGACACCCTATTAATA
T
C
C
C
G
A
G
T
A
G
A
C
A
G
A
G
C
A
G
A
C
A
C
C
C
T
A
T
T
A
A
T
A
Genes: N9EI86IKDFC

Composition

Poodle
18%
Pitbull terrier
9%
French Bulldog
9%
Shiba Inu
9%
Golder Retriever
9%
Labrador BK
9%
Maltese
9%
Beagle
9%
Yorkshire Terrier
9%
Schnauzer
9%

Current Energy

Vitality -53 points
Lunar Effect -2 points

Traits Breakdown

Body Pitbull terrier
Tail French Bulldog
Legs Shiba Inu
Front Legs Poodle
Head Golder Retriever
Ears Labrador BK
Snout Poodle
Mouth Maltese
Nose Beagle
Eyes Yorkshire Terrier
Color Schnauzer

Parents

No Children