Lili Lizzy Cryptocurrency Game Dog - Mix of Pitbull terrier, Pug, Border Collie, Labrador, Labrador BK, St. Bernard, Husky, Schnauzer and Rottweiler

Achievements

None
Lili Lizzy
Salutations! My name's Lili Lizzy. Halloween costumes are the worst, I hate 'em! I love it when you show a little teeth. Slipping my collar, running off and making my humans worried? Every chance I get. I'm trying to find a partner in crime to help me dig through the trash for the good stuff.
  • Purity 3%
  • Age 43 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTCCGAACCATCCGCAGAATGAACAATACAC
T
A
C
T
C
C
G
A
A
C
C
A
T
C
C
G
C
A
G
A
A
T
G
A
A
C
A
A
T
A
C
A
C
Genes: JN25N62B4CH

Composition

Pitbull terrier
18%
Pug
18%
Border Collie
9%
Labrador
9%
Labrador BK
9%
St. Bernard
9%
Husky
9%
Schnauzer
9%
Rottweiler
9%

Current Energy

Vitality -42 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Pitbull terrier
Legs Pug
Front Legs Labrador
Head Pitbull terrier
Ears Labrador BK
Snout Pug
Mouth St. Bernard
Nose Husky
Eyes Schnauzer
Color Rottweiler