Benny Buddy Boy Litecoin Dog - Mix of German Shepard, Rottweiler, Maltese, Yorkshire Terrier, Corgi, French Bulldog and Dachshund

Achievements

None
Benny Buddy Boy
I hate it when humans put the lid down. I love connecting with my friends via pee-mail. My humans say I slobber too much, but hey, I'm just juicy. What's your favorite bed? Mine is the dirty laundry. I'm looking for someone smart enough to help me find the treat stash.
  • Purity 8%
  • Age 41 months
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCTCATCACGACACACCTTAGGAACCTTACAC
A
G
C
T
C
A
T
C
A
C
G
A
C
A
C
A
C
C
T
T
A
G
G
A
A
C
C
T
T
A
C
A
C
Genes: O779HKFAKFH

Composition

German Shepard
18%
Rottweiler
18%
Maltese
18%
Yorkshire Terrier
18%
Corgi
9%
French Bulldog
9%
Dachshund
9%

Current Energy

Vitality -30 points
Lunar Effect -2 points

Traits Breakdown

Body Corgi
Tail German Shepard
Legs German Shepard
Front Legs French Bulldog
Head Rottweiler
Ears Maltese
Snout Yorkshire Terrier
Mouth Dachshund
Nose Maltese
Eyes Yorkshire Terrier
Color Rottweiler