Banjo Birdy Cryptocurrency Dog - Mix of Corgi, Labrador, Golder Retriever, Border Collie, Maltese, German Shepard, Schnauzer and Labrador BK

Achievements

None
Banjo Birdy
Hey there... I'm Banjo Birdy. You can access my database anytime with your WiFi. Rolling around on the carpet after a bath is my favorite way to dry. If I can't reach it to clean it myself, it doesn't need cleaning! Don't bother contacting me if you like cats.
  • Purity 8%
  • Age 42 months
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAAGCCCATACACCTCAAGCAGCATACCAGCA
A
G
A
A
G
C
C
C
A
T
A
C
A
C
C
T
C
A
A
G
C
A
G
C
A
T
A
C
C
A
G
C
A
Genes: 8O5JK7OOC56

Composition

Corgi
27%
Labrador
18%
Golder Retriever
9%
Border Collie
9%
Maltese
9%
German Shepard
9%
Schnauzer
9%
Labrador BK
9%

Current Energy

Vitality -24 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail Corgi
Legs Labrador
Front Legs Border Collie
Head Maltese
Ears German Shepard
Snout Corgi
Mouth Corgi
Nose Schnauzer
Eyes Labrador
Color Labrador BK