Rex Rikimaru Bitcoin Game Dog - Mix of Poodle, Border Collie, Shiba Inu, Husky, German Shepard, Beagle, Corgi, Schnauzer and Pug

Achievements

None
Rex Rikimaru
This dawg chases mice in a big data warehouse. Blue toilet water turns me off. I love connecting with my friends via pee-mail. Steak is my absolute favorite, but I prefer to eat chicken for my health. Oh, go ahead. Pet me. I know you want to.
  • Purity 5%
  • Age 43 months
  • Racing Exp 0
  • Poodle 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGACACATCATACTACCTAGACAGCATAGAA
G
T
A
G
A
C
A
C
A
T
C
A
T
A
C
T
A
C
C
T
A
G
A
C
A
G
C
A
T
A
G
A
A
Genes: EI47JJDIOC2

Composition

Poodle
18%
Border Collie
18%
Shiba Inu
9%
Husky
9%
German Shepard
9%
Beagle
9%
Corgi
9%
Schnauzer
9%
Pug
9%

Current Energy

Vitality -12 points
Lunar Effect +2 points

Traits Breakdown

Body Shiba Inu
Tail Poodle
Legs Husky
Front Legs German Shepard
Head Border Collie
Ears Border Collie
Snout Beagle
Mouth Poodle
Nose Corgi
Eyes Schnauzer
Color Pug