Nani Nellie Bitcoin Dog - Mix of Corgi, Labrador, Husky, Shiba Inu, Rottweiler, Dachshund, Border Collie, Beagle and Schnauzer

Achievements

None
Nani Nellie
The Ethernet where I live, rocks. I cry whenever I hear an ambulance siren! I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 3%
  • Age 41 months
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGTAAGCCACGGAAGCCCATACCTACCAATA
A
C
A
G
T
A
A
G
C
C
A
C
G
G
A
A
G
C
C
C
A
T
A
C
C
T
A
C
C
A
A
T
A
Genes: 4EOHAO5JD5C

Composition

Corgi
18%
Labrador
18%
Husky
9%
Shiba Inu
9%
Rottweiler
9%
Dachshund
9%
Border Collie
9%
Beagle
9%
Schnauzer
9%

Current Energy

Vitality -35 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs Corgi
Front Legs Rottweiler
Head Dachshund
Ears Corgi
Snout Labrador
Mouth Border Collie
Nose Beagle
Eyes Labrador
Color Schnauzer