Elvis Elmo Crypto Game Dog - Mix of Yorkshire Terrier, Schnauzer, Rottweiler, French Bulldog, Maltese, Husky, Labrador BK, Boxer and Corgi
Elvis Elmo
  • Purity 5%
  • Age 75 months
  • Racing Exp 56
  • Yorkshire Terrier 18%
  • Gold medal 4 Silver medal 0 Bronze medal 3
  • 13 races
  • Gen 0
Ecstatic & Fast

Achievements

Pro Racer

Bio

In the big data server, I sorta rule. I hate it when humans put the lid down. I like to respond to sad puppy eyes with sad puppy eyes of my own. My favorite way to relax is to be scratched on my belly. Oh, go ahead. Pet me. I know you want to.

Racing Stats

Ran 13 races
  • 4 0 3
 Best Time15.77 sec
No rank  RacingĀ *** Pts
53.8% wins (7) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACCGAACCACAGCATTAAACAGCATAATATTA
C
A
C
C
G
A
A
C
C
A
C
A
G
C
A
T
T
A
A
A
C
A
G
C
A
T
A
A
T
A
T
T
A
Genes: H9K46FGOCCF

Composition

Yorkshire Terrier
18%
Schnauzer
18%
Rottweiler
9%
French Bulldog
9%
Maltese
9%
Husky
9%
Labrador BK
9%
Boxer
9%
Corgi
9%

Current Energy

Vitality -42 points
Lunar Effect +6 points

Traits Breakdown

Body Rottweiler
Tail French Bulldog
Legs Maltese
Front Legs Husky
Head Labrador BK
Ears Yorkshire Terrier
Snout Boxer
Mouth Corgi
Nose Schnauzer
Eyes Schnauzer
Color Yorkshire Terrier

Parents

No Children

Photos

cryptocurrency dog race photo online dog racing virtual dog race crypto pet racing online canine racing virtual canine racing results virtual dog race Bitcoin pet racing photo
Gift