Elvis Elmo Crypto Game Dog - Mix of Yorkshire Terrier, Schnauzer, Rottweiler, French Bulldog, Maltese, Husky, Labrador BK, Boxer and Corgi

Achievements

Racer
Elvis Elmo
In the big data server, I sorta rule. I hate it when humans put the lid down. I like to respond to sad puppy eyes with sad puppy eyes of my own. My favorite way to relax is to be scratched on my belly. Oh, go ahead. Pet me. I know you want to.
  • Purity 5%
  • Age 41 months
  • Racing Exp 8
  • Yorkshire Terrier 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
3 races    Best Time17.15 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCGAACCACAGCATTAAACAGCATAATATTA
C
A
C
C
G
A
A
C
C
A
C
A
G
C
A
T
T
A
A
A
C
A
G
C
A
T
A
A
T
A
T
T
A
Genes: H9K46FGOCCF

Composition

Yorkshire Terrier
18%
Schnauzer
18%
Rottweiler
9%
French Bulldog
9%
Maltese
9%
Husky
9%
Labrador BK
9%
Boxer
9%
Corgi
9%

Current Energy

Vitality -42 points
Lunar Effect +6 points

Traits Breakdown

Body Rottweiler
Tail French Bulldog
Legs Maltese
Front Legs Husky
Head Labrador BK
Ears Yorkshire Terrier
Snout Boxer
Mouth Corgi
Nose Schnauzer
Eyes Schnauzer
Color Yorkshire Terrier