Timmy Theo Digital Cryptocurrency Dog - Mix of Pitbull terrier, Golder Retriever, Beagle, Corgi, Labrador BK, Shiba Inu and Dachshund

Achievements

None
Timmy Theo
My favorite chews are underwear and rawhide...the rawhide lasts longer. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! You know the worst? Watching my humans 'get it on' and I have to lick myself. Those flying monkeys in the Wizard of Oz still scare me!
  • Purity 8%
  • Age 41 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATCCAGACTATCCAGACTAGTAGGAAGCAGC
G
C
A
T
C
C
A
G
A
C
T
A
T
C
C
A
G
A
C
T
A
G
T
A
G
G
A
A
G
C
A
G
C
Genes: 6N8DN8DEAOO

Composition

Pitbull terrier
18%
Golder Retriever
18%
Beagle
18%
Corgi
18%
Labrador BK
9%
Shiba Inu
9%
Dachshund
9%

Current Energy

Vitality -35 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador BK
Tail Pitbull terrier
Legs Golder Retriever
Front Legs Beagle
Head Pitbull terrier
Ears Golder Retriever
Snout Beagle
Mouth Shiba Inu
Nose Dachshund
Eyes Corgi
Color Corgi