Lovey Lynx Litecoin Game Dog - Mix of Maltese, Pug, Corgi, Yorkshire Terrier, Husky and Labrador BK

Achievements

None
Lovey Lynx
I've been known to run with bad dogs. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I enjoy staying active, and running circles around puppies and young children. You know the worst? Watching my humans 'get it on' when I've got no one.
  • Purity 16%
  • Age 4 months
  • Racing Exp 0
  • Maltese 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAAGCACAACCACCACCGCAAGCTTATTAGAA
G
A
A
A
G
C
A
C
A
A
C
C
A
C
C
A
C
C
G
C
A
A
G
C
T
T
A
T
T
A
G
A
A
Genes: 2O4KKK6OFF2

Composition

Maltese
27%
Pug
18%
Corgi
18%
Yorkshire Terrier
18%
Husky
9%
Labrador BK
9%

Current Energy

Vitality -51 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Corgi
Legs Husky
Front Legs Maltese
Head Maltese
Ears Maltese
Snout Labrador BK
Mouth Corgi
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Pug