Dots Darlene Bitcoin Dog - Mix of Yorkshire Terrier, St. Bernard, Rottweiler, Pitbull terrier, Corgi, Border Collie, Labrador BK and Pug

Achievements

Racer
Dots Darlene
I live in cyberspace where you can turn me on. I hate going to the vet and will do almost anything to avoid it. If you enjoy growling through fences as much as I do, we should get together. I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.
  • Purity 8%
  • Age 39 months
  • Racing Exp 6
  • Yorkshire Terrier 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 1
 Best Time16.92 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCTTAAGCTACGCATGATGACACCACGAATTA
T
C
C
T
T
A
A
G
C
T
A
C
G
C
A
T
G
A
T
G
A
C
A
C
C
A
C
G
A
A
T
T
A
Genes: NFOJ6BBHH2F

Composition

Yorkshire Terrier
18%
St. Bernard
18%
Rottweiler
18%
Pitbull terrier
9%
Corgi
9%
Border Collie
9%
Labrador BK
9%
Pug
9%

Current Energy

Vitality -33 points
Lunar Effect +6 points

Traits Breakdown

Body Pitbull terrier
Tail Yorkshire Terrier
Legs Corgi
Front Legs Border Collie
Head Labrador BK
Ears St. Bernard
Snout St. Bernard
Mouth Rottweiler
Nose Rottweiler
Eyes Pug
Color Yorkshire Terrier

Parents

No Children

Photos

Bitcoin dog racing