Missy Miko Cryptocurrency Dog - Mix of German Shepard, Yorkshire Terrier, Golder Retriever, Labrador, Dachshund, Beagle and Labrador BK

Achievements

None
Missy Miko
Whatcha know, honey. Missy Miko here. Air Bud is definitely my favorite movie. What a role model! If I can't reach it to clean it myself, it doesn't need cleaning! I hate it when my human runs out of poop-bags. How embarrassing! I'm ready to settle down and have puppies...what about you?
  • Purity 6%
  • Age 42 months
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATTATCAAGACCAGGACCACTAAGAGCATTA
T
C
A
T
T
A
T
C
A
A
G
A
C
C
A
G
G
A
C
C
A
C
T
A
A
G
A
G
C
A
T
T
A
Genes: 7F785A5D86F

Composition

German Shepard
18%
Yorkshire Terrier
18%
Golder Retriever
18%
Labrador
18%
Dachshund
9%
Beagle
9%
Labrador BK
9%

Current Energy

Vitality -12 points
Lunar Effect -10 points

Traits Breakdown

Body German Shepard
Tail Yorkshire Terrier
Legs German Shepard
Front Legs Golder Retriever
Head Labrador
Ears Dachshund
Snout Labrador
Mouth Beagle
Nose Golder Retriever
Eyes Labrador BK
Color Yorkshire Terrier