Spud Stinky Crypto Dog - Mix of German Shepard, Border Collie, Corgi, Labrador BK, St. Bernard, Grey Wolf and Pug

Achievements

None
Spud Stinky
Hello, there. Spud Stinky here. Taking a break from chasing Nyan Cat around cyberspace. My human says I'm loyal, intelligent, devoted and affectionate. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I hate it when my humans fart and they blame me!
  • Purity 11%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATGACCCTCATCATACGAAAGCAGCTCATAC
G
C
A
T
G
A
C
C
C
T
C
A
T
C
A
T
A
C
G
A
A
A
G
C
A
G
C
T
C
A
T
A
C
Genes: 6BL77J2OO7J

Composition

German Shepard
27%
Border Collie
18%
Corgi
18%
Labrador BK
9%
St. Bernard
9%
Grey Wolf
9%
Pug
9%

Current Energy

Vitality +13 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador BK
Tail St. Bernard
Legs Grey Wolf
Front Legs German Shepard
Head German Shepard
Ears Border Collie
Snout Pug
Mouth Corgi
Nose Corgi
Eyes German Shepard
Color Border Collie