Bronx Bomber Bruiser Crypto Dog - Mix of Husky, Boxer, Border Collie, Pug, Yorkshire Terrier and Poodle

Achievements

Racer
Bronx Bomber Bruiser
Salutations! My name's Bronx Bomber Bruiser. The Ethernet where I live, rocks. I really dislike stinky flea collars. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'll lick anything. I like big butts, I cannot lie.
  • Purity 12%
  • Age 9 months
  • Racing Exp 9
  • Husky 27%
  • 2 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 1 0 0
 Best Time15.52 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTACTACTTAAACGAAACAACAGACGAAACA
A
A
C
T
A
C
T
A
C
T
T
A
A
A
C
G
A
A
A
C
A
A
C
A
G
A
C
G
A
A
A
C
A
Genes: GJJFG244I24

Composition

Husky
27%
Boxer
18%
Border Collie
18%
Pug
18%
Yorkshire Terrier
9%
Poodle
9%

Current Energy

Vitality -32 points
Lunar Effect +14 points

Traits Breakdown

Body Boxer
Tail Border Collie
Legs Border Collie
Front Legs Yorkshire Terrier
Head Boxer
Ears Pug
Snout Husky
Mouth Husky
Nose Poodle
Eyes Pug
Color Husky

Parents

No Children

Photos

Bitcoin dog race podium