Rolls Royce Ringo Crypto Dog - Mix of Pug, Beagle, Labrador BK, Maltese, Golder Retriever, Poodle, Pitbull terrier, Schnauzer, St. Bernard and Corgi

Achievements

None
Rolls Royce Ringo
Taking a break from chasing Nyan Cat around cyberspace. I'm into leather...if I have the right partner. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I want a mate that knows how to give a proper belly rub!
  • Purity 1%
  • Age 41 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAGCAACCAGAGACTCCATATGAGAAAGCGAA
C
T
A
G
C
A
A
C
C
A
G
A
G
A
C
T
C
C
A
T
A
T
G
A
G
A
A
A
G
C
G
A
A
Genes: D6K8INCB2O2

Composition

Pug
18%
Beagle
9%
Labrador BK
9%
Maltese
9%
Golder Retriever
9%
Poodle
9%
Pitbull terrier
9%
Schnauzer
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -57 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Labrador BK
Legs Maltese
Front Legs Golder Retriever
Head Poodle
Ears Pitbull terrier
Snout Schnauzer
Mouth St. Bernard
Nose Pug
Eyes Corgi
Color Pug