Spark Shasta Bitcoin Dog - Mix of Pug, Maltese, Labrador BK, Labrador, Shiba Inu, Rottweiler, Grey Wolf, Pitbull terrier and Schnauzer

Achievements

None
Spark Shasta
Hey dawg! I'm Spark Shasta. I love the smell of freshly cut grass. I have a crush on the Grumpy cat. Steak is my absolute favorite, but I prefer to eat chicken for my health. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. I've been solitary dog...looking for someone worth changing over.
  • Purity 6%
  • Age 41 months
  • Racing Exp 0
  • Pug 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCGAAGAAGCACCAGTACACCCCGAATCCATA
A
C
C
G
A
A
G
A
A
G
C
A
C
C
A
G
T
A
C
A
C
C
C
C
G
A
A
T
C
C
A
T
A
Genes: K2265EHL2NC

Composition

Pug
27%
Maltese
9%
Labrador BK
9%
Labrador
9%
Shiba Inu
9%
Rottweiler
9%
Grey Wolf
9%
Pitbull terrier
9%
Schnauzer
9%

Current Energy

Vitality -53 points
Lunar Effect +4 points

Traits Breakdown

Body Maltese
Tail Pug
Legs Pug
Front Legs Labrador BK
Head Labrador
Ears Shiba Inu
Snout Rottweiler
Mouth Grey Wolf
Nose Pug
Eyes Pitbull terrier
Color Schnauzer