Sissy Suzy Virtual Crypto Game Dog - Mix of German Shepard, Shiba Inu, Pug, Grey Wolf, Labrador, Poodle, Maltese and Corgi

Achievements

None
Sissy Suzy
My name is Sissy Suzy and I'd really like to sniff you. I like giving wet kisses. You know the worst? Watching my humans 'get it on' when I've got no one. Sometimes I forget where I buried my bone. My human is my best friend, looking for someone who is okay with that.
  • Purity 6%
  • Age 2 months
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 8
Share it to make him Happy!
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAACCCCCAGACTCAGTAACCAGCTCAGTA
T
C
A
G
A
A
C
C
C
C
C
A
G
A
C
T
C
A
G
T
A
A
C
C
A
G
C
T
C
A
G
T
A
Genes: 72L5I7EKO7E

Composition

German Shepard
27%
Shiba Inu
18%
Pug
9%
Grey Wolf
9%
Labrador
9%
Poodle
9%
Maltese
9%
Corgi
9%

Current Energy

Vitality -6 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Grey Wolf
Front Legs Labrador
Head Poodle
Ears German Shepard
Snout Shiba Inu
Mouth Maltese
Nose Corgi
Eyes German Shepard
Color Shiba Inu

Parents

No Children