Woofer Widget Bitcoin Game Dog - Mix of Golder Retriever, Schnauzer, Labrador, Beagle and Rottweiler

Achievements

None
Woofer Widget
Nice to meet you! I'm Woofer Widget. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I don't like to be ignored. My humans say I bark too much, but I have a lot to say! When I can break free, I enjoy exploring my neighborhood without my human.
  • Purity 21%
  • Age 39 months
  • Racing Exp 0
  • Golder Retriever 45%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATACCAAGAAGACTAAGACCAATACACAGAAGA
A
T
A
C
C
A
A
G
A
A
G
A
C
T
A
A
G
A
C
C
A
A
T
A
C
A
C
A
G
A
A
G
A
Genes: C588D85CH88

Composition

Golder Retriever
45%
Schnauzer
18%
Labrador
18%
Beagle
9%
Rottweiler
9%

Current Energy

Vitality -39 points
Lunar Effect -18 points

Traits Breakdown

Body Schnauzer
Tail Labrador
Legs Golder Retriever
Front Legs Golder Retriever
Head Beagle
Ears Golder Retriever
Snout Labrador
Mouth Schnauzer
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever