Teddybear Trinity Bitcoin Dog - Mix of Poodle, German Shepard, Labrador BK, Maltese, Schnauzer, Pug, Corgi and Boxer

Achievements

Racer
Teddybear Trinity
How do you do? I'm Teddybear Trinity. Forget plastic hotdogs...I'm into the classic chew toys like slippers. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I may need de-worming. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary!
  • Purity 4%
  • Age 39 months
  • Racing Exp 2
  • Poodle 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time16.35 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACACCATATCAGACGCAGAAGCATCAAGCAAC
G
A
C
A
C
C
A
T
A
T
C
A
G
A
C
G
C
A
G
A
A
G
C
A
T
C
A
A
G
C
A
A
C
Genes: IKC7I6267OG

Composition

Poodle
18%
German Shepard
18%
Labrador BK
18%
Maltese
9%
Schnauzer
9%
Pug
9%
Corgi
9%
Boxer
9%

Current Energy

Vitality -42 points
Lunar Effect +6 points

Traits Breakdown

Body Poodle
Tail Maltese
Legs Schnauzer
Front Legs German Shepard
Head Poodle
Ears Labrador BK
Snout Pug
Mouth Labrador BK
Nose German Shepard
Eyes Corgi
Color Boxer