Yukon Yukon Bitcoin Dog - Mix of Grey Wolf, Husky, St. Bernard, Border Collie, Labrador, German Shepard, Shiba Inu, Rottweiler and Dachshund

Achievements

None
Yukon Yukon
They call me Yukon Yukon. What's your name? I'd like to take you for a byte to eat in cyberspace. If you enjoy growling through fences as much as I do, we should get together. Too much steak gives me the runs! I enjoy exploration and am game for anything doggy-style.
  • Purity 3%
  • Age 39 months
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGATACCCATCACCCACAGTAACACACGGACCC
T
G
A
T
A
C
C
C
A
T
C
A
C
C
C
A
C
A
G
T
A
A
C
A
C
A
C
G
G
A
C
C
C
Genes: BJ57L4E4HAL

Composition

Grey Wolf
18%
Husky
18%
St. Bernard
9%
Border Collie
9%
Labrador
9%
German Shepard
9%
Shiba Inu
9%
Rottweiler
9%
Dachshund
9%

Current Energy

Vitality -27 points
Lunar Effect -10 points

Traits Breakdown

Body St. Bernard
Tail Border Collie
Legs Labrador
Front Legs German Shepard
Head Grey Wolf
Ears Husky
Snout Shiba Inu
Mouth Husky
Nose Rottweiler
Eyes Dachshund
Color Grey Wolf