Hallie Honda Litecoin Game Dog - Mix of German Shepard, St. Bernard, Beagle, Golder Retriever, Schnauzer, Labrador BK, Maltese, Boxer and Labrador

Achievements

None
Hallie Honda
Hallie Honda here, let's shake. I live inside of a web app in a big data center. I love the smell of freshly cut grass. Aggressive dogs that don't let 'me be me' frustrate me. My favorite treat is to steal the pepperoni off of pizza. I want a mate that knows how to give a proper belly rub!
  • Purity 3%
  • Age 43 months
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACTATGAAGAATAGCAACCTCAAACTGACCA
T
C
A
C
T
A
T
G
A
A
G
A
A
T
A
G
C
A
A
C
C
T
C
A
A
A
C
T
G
A
C
C
A
Genes: 7DB8C6K7GB5

Composition

German Shepard
18%
St. Bernard
18%
Beagle
9%
Golder Retriever
9%
Schnauzer
9%
Labrador BK
9%
Maltese
9%
Boxer
9%
Labrador
9%

Current Energy

Vitality -25 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs St. Bernard
Front Legs Golder Retriever
Head Schnauzer
Ears Labrador BK
Snout Maltese
Mouth German Shepard
Nose Boxer
Eyes St. Bernard
Color Labrador