Emmitt Erin Cryptocurrency Game Dog - Mix of Rottweiler, Yorkshire Terrier, German Shepard, Pitbull terrier, St. Bernard, Husky, Border Collie and Labrador

Achievements

None
Emmitt Erin
As a digital dog, let me say Bob Dole did not invent the internet. Spiked dog collars really turn me on. Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I don't appreciate being around bores who bark too much. I enjoy going to the dog park to see all my friends!
  • Purity 6%
  • Age 39 months
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTATCATCCTGAACACACTACCACCCATTACAC
T
T
A
T
C
A
T
C
C
T
G
A
A
C
A
C
A
C
T
A
C
C
A
C
C
C
A
T
T
A
C
A
C
Genes: F7NB4HJH5FH

Composition

Rottweiler
27%
Yorkshire Terrier
18%
German Shepard
9%
Pitbull terrier
9%
St. Bernard
9%
Husky
9%
Border Collie
9%
Labrador
9%

Current Energy

Vitality -35 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail German Shepard
Legs Pitbull terrier
Front Legs St. Bernard
Head Husky
Ears Rottweiler
Snout Border Collie
Mouth Rottweiler
Nose Labrador
Eyes Yorkshire Terrier
Color Rottweiler