Sadie Sinker Bitcoin Dog - Mix of Labrador, Corgi, Golder Retriever, Border Collie, Pug, St. Bernard and Beagle

Achievements

None
Sadie Sinker
Well hello, beautiful. My name's Sadie Sinker. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I'll be honest...Napping is my favorite so we gotta go slow. Getting out of a long relationship, not looking for another
  • Purity 9%
  • Age 42 months
  • Racing Exp 0
  • Labrador 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACAGCCCAAGAAGACCAAGCCCAGAATGACTA
T
A
C
A
G
C
C
C
A
A
G
A
A
G
A
C
C
A
A
G
C
C
C
A
G
A
A
T
G
A
C
T
A
Genes: JO5885O52BD

Composition

Labrador
27%
Corgi
18%
Golder Retriever
18%
Border Collie
9%
Pug
9%
St. Bernard
9%
Beagle
9%

Current Energy

Vitality -25 points
Lunar Effect -2 points

Traits Breakdown

Body Border Collie
Tail Corgi
Legs Labrador
Front Legs Golder Retriever
Head Golder Retriever
Ears Labrador
Snout Corgi
Mouth Labrador
Nose Pug
Eyes St. Bernard
Color Beagle