Freddie Fullback Litecoin Dog - Mix of German Shepard, Beagle, Maltese, French Bulldog, Labrador, Rottweiler and Dachshund

Achievements

Racer
Freddie Fullback
Sup? ;-) I'm Freddie Fullback. I'm a super-dog in the internet universe. I enjoy mixing it up once in a while by visiting different dog parks. I'll lick anything. Blue toilet water turns me off. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!
  • Purity 6%
  • Age 4 months
  • Racing Exp 13
  • German Shepard 18%
  • 2 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 1 1
 Best Time15.63 sec
No rank  Racing *** Coins
100.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACTAACCCGACTACCACACCGAACCTCAGGA
T
C
A
C
T
A
A
C
C
C
G
A
C
T
A
C
C
A
C
A
C
C
G
A
A
C
C
T
C
A
G
G
A
Genes: 7DK9D5H9K7A

Composition

German Shepard
18%
Beagle
18%
Maltese
18%
French Bulldog
18%
Labrador
9%
Rottweiler
9%
Dachshund
9%

Current Energy

Vitality -45 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs Maltese
Front Legs French Bulldog
Head Beagle
Ears Labrador
Snout Rottweiler
Mouth French Bulldog
Nose Maltese
Eyes German Shepard
Color Dachshund