Benji Bell Crypto Dog - Mix of Border Collie, Golder Retriever, Schnauzer, Grey Wolf, German Shepard, Maltese, St. Bernard and French Bulldog

Achievements

Racer
Benji Bell
Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? Little Bow Wow is my favorite musician. I just assume he's a dog... I've been known to run with bad dogs. I am a proud show dog. I like showing off my perfect coat!
  • Purity 9%
  • Age 39 months
  • Racing Exp 2
  • Border Collie 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time17.38 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATACCCTCAACCTACTACTGATACCGAAGAAGA
A
T
A
C
C
C
T
C
A
A
C
C
T
A
C
T
A
C
T
G
A
T
A
C
C
G
A
A
G
A
A
G
A
Genes: CL7KJJBJ988

Composition

Border Collie
27%
Golder Retriever
18%
Schnauzer
9%
Grey Wolf
9%
German Shepard
9%
Maltese
9%
St. Bernard
9%
French Bulldog
9%

Current Energy

Vitality -37 points
Lunar Effect -2 points

Traits Breakdown

Body Schnauzer
Tail Grey Wolf
Legs German Shepard
Front Legs Maltese
Head Border Collie
Ears Border Collie
Snout St. Bernard
Mouth Border Collie
Nose French Bulldog
Eyes Golder Retriever
Color Golder Retriever