Wrinkles Wrinkles Litecoin Dog - Mix of Beagle, Dachshund, Grey Wolf, Golder Retriever, Border Collie, Boxer, Poodle and St. Bernard

Achievements

None
Wrinkles Wrinkles
I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'm the best at running circle 8's. I'll lick anything. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! New experiences? New treats? New places! Yes, please!
  • Purity 6%
  • Age 39 months
  • Racing Exp 0
  • Beagle 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGACCCCTAAGATACCTAAACGGACTAGACTGA
G
G
A
C
C
C
C
T
A
A
G
A
T
A
C
C
T
A
A
A
C
G
G
A
C
T
A
G
A
C
T
G
A
Genes: ALD8JDGADIB

Composition

Beagle
27%
Dachshund
18%
Grey Wolf
9%
Golder Retriever
9%
Border Collie
9%
Boxer
9%
Poodle
9%
St. Bernard
9%

Current Energy

Vitality -32 points
Lunar Effect -6 points

Traits Breakdown

Body Dachshund
Tail Grey Wolf
Legs Beagle
Front Legs Golder Retriever
Head Border Collie
Ears Beagle
Snout Boxer
Mouth Dachshund
Nose Beagle
Eyes Poodle
Color St. Bernard