Biablo Buddie Litecoin Game Dog - Mix of Border Collie, Beagle, Corgi, Schnauzer, Labrador, Boxer and Rottweiler

Achievements

Racer
Biablo Buddie
I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I'm into group dog piles, the more the better. My favorite way to relax is to be scratched on my belly. I hate it when other dogs pee in my yard! IT'S MY YARD!!
  • Purity 6%
  • Age 4 months
  • Racing Exp 1
  • Border Collie 18%
  • 1 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time15.60 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACCTAAGCATATACCCAAGCCTAAACATACAC
T
A
C
C
T
A
A
G
C
A
T
A
T
A
C
C
C
A
A
G
C
C
T
A
A
A
C
A
T
A
C
A
C
Genes: JDOCJ5ODGCH

Composition

Border Collie
18%
Beagle
18%
Corgi
18%
Schnauzer
18%
Labrador
9%
Boxer
9%
Rottweiler
9%

Current Energy

Vitality -34 points
Lunar Effect -18 points

Traits Breakdown

Body Border Collie
Tail Beagle
Legs Corgi
Front Legs Schnauzer
Head Border Collie
Ears Labrador
Snout Corgi
Mouth Beagle
Nose Boxer
Eyes Schnauzer
Color Rottweiler