Duffy Debo Crypto Dog - Mix of Pitbull terrier, Border Collie, Yorkshire Terrier, Pug, German Shepard, Labrador, Golder Retriever, Grey Wolf, Poodle and Dachshund

Achievements

None
Duffy Debo
They call me Duffy Debo. What's your name? Here in cyberspace, I ain't got much use for a floppy disc. My favorite game is Fetch except I never bring the ball back. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks...
  • Purity 1%
  • Age 41 months
  • Racing Exp 0
  • Pitbull terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTTAGAATCACCATCCAGACCCTCCGACGGA
T
A
C
T
T
A
G
A
A
T
C
A
C
C
A
T
C
C
A
G
A
C
C
C
T
C
C
G
A
C
G
G
A
Genes: JF275N8LNIA

Composition

Pitbull terrier
18%
Border Collie
9%
Yorkshire Terrier
9%
Pug
9%
German Shepard
9%
Labrador
9%
Golder Retriever
9%
Grey Wolf
9%
Poodle
9%
Dachshund
9%

Current Energy

Vitality -41 points
Lunar Effect -16 points

Traits Breakdown

Body Border Collie
Tail Yorkshire Terrier
Legs Pug
Front Legs German Shepard
Head Labrador
Ears Pitbull terrier
Snout Golder Retriever
Mouth Grey Wolf
Nose Pitbull terrier
Eyes Poodle
Color Dachshund