Cricket Chopper Litecoin Dog - Mix of Maltese, Labrador, Corgi, Border Collie, Grey Wolf, Rottweiler, Pug and Poodle

Achievements

None
Cricket Chopper
The place I like most in the world is curled up in my human's bed, hogging all the covers! I hate it when I am not the center of attention. I've always had a crush on Lassie. I like to play fetch with a tennis ball. Being able to lick myself is nice, but I want to find my special someone.
  • Purity 4%
  • Age 41 months
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCTACCCCCACCCAACCAGCGAAAGCCCAGAC
A
C
C
T
A
C
C
C
C
C
A
C
C
C
A
A
C
C
A
G
C
G
A
A
A
G
C
C
C
A
G
A
C
Genes: KJLH5KO2O5I

Composition

Maltese
18%
Labrador
18%
Corgi
18%
Border Collie
9%
Grey Wolf
9%
Rottweiler
9%
Pug
9%
Poodle
9%

Current Energy

Vitality -37 points
Lunar Effect -2 points

Traits Breakdown

Body Maltese
Tail Border Collie
Legs Grey Wolf
Front Legs Rottweiler
Head Labrador
Ears Maltese
Snout Corgi
Mouth Pug
Nose Corgi
Eyes Labrador
Color Poodle