Mother Brain Marky Mark Bitcoin Game Dog - Mix of Pug, Corgi, Boxer, Border Collie, Golder Retriever, Schnauzer, Maltese, Shiba Inu, French Bulldog and St. Bernard

Achievements

None
Mother Brain Marky Mark
I answer to 'Mother Brain Marky Mark'. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I'm looking for some ruff play. Wanna bite me?
  • Purity 1%
  • Age 42 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCAACTACAGAGAAATAACCGTAGAACGATGA
A
G
C
A
A
C
T
A
C
A
G
A
G
A
A
A
T
A
A
C
C
G
T
A
G
A
A
C
G
A
T
G
A
Genes: OGJ82CKE29B

Composition

Pug
18%
Corgi
9%
Boxer
9%
Border Collie
9%
Golder Retriever
9%
Schnauzer
9%
Maltese
9%
Shiba Inu
9%
French Bulldog
9%
St. Bernard
9%

Current Energy

Vitality -27 points
Lunar Effect +4 points

Traits Breakdown

Body Corgi
Tail Boxer
Legs Border Collie
Front Legs Golder Retriever
Head Pug
Ears Schnauzer
Snout Maltese
Mouth Shiba Inu
Nose Pug
Eyes French Bulldog
Color St. Bernard