Peaches Proto Man Crypto Dog - Mix of Pug, Poodle, Schnauzer, Golder Retriever, French Bulldog, Maltese, Boxer, Pitbull terrier, Border Collie and German Shepard

Achievements

None
Peaches Proto Man
Well hello, beautiful. My name's Peaches Proto Man. My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I've had my nose rubbed in 'it' more than once. Aggressive dogs that don't let 'me be me' frustrate me.
  • Purity 1%
  • Age 39 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACATAGAAAGACGAACCGAAAACTCCTACTCA
G
A
C
A
T
A
G
A
A
A
G
A
C
G
A
A
C
C
G
A
A
A
A
C
T
C
C
T
A
C
T
C
A
Genes: IC289K2GNJ7

Composition

Pug
18%
Poodle
9%
Schnauzer
9%
Golder Retriever
9%
French Bulldog
9%
Maltese
9%
Boxer
9%
Pitbull terrier
9%
Border Collie
9%
German Shepard
9%

Current Energy

Vitality -42 points
Lunar Effect -4 points

Traits Breakdown

Body Poodle
Tail Schnauzer
Legs Pug
Front Legs Golder Retriever
Head French Bulldog
Ears Maltese
Snout Pug
Mouth Boxer
Nose Pitbull terrier
Eyes Border Collie
Color German Shepard

Parents

No Children