Baller Bug Bitcoin Dog - Mix of Border Collie, St. Bernard, Pitbull terrier, Corgi, Boxer, Grey Wolf, Pug, Golder Retriever, Labrador and Rottweiler

Achievements

None
Baller Bug
Hullo. My name is Baller Bug. I'm not a bad dog, my data is just configured that way. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 1%
  • Age 43 months
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TGATACTCCAGCTACAACCCCGAAAGACCACAC
T
G
A
T
A
C
T
C
C
A
G
C
T
A
C
A
A
C
C
C
C
G
A
A
A
G
A
C
C
A
C
A
C
Genes: BJNOJGL285H

Composition

Border Collie
18%
St. Bernard
9%
Pitbull terrier
9%
Corgi
9%
Boxer
9%
Grey Wolf
9%
Pug
9%
Golder Retriever
9%
Labrador
9%
Rottweiler
9%

Current Energy

Vitality -42 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail Border Collie
Legs Pitbull terrier
Front Legs Corgi
Head Border Collie
Ears Boxer
Snout Grey Wolf
Mouth Pug
Nose Golder Retriever
Eyes Labrador
Color Rottweiler