Lexie Little-Guy Litecoin Game Dog - Mix of St. Bernard, German Shepard, Pug, Grey Wolf, French Bulldog, Border Collie and Maltese

Achievements

None
Lexie Little-Guy
Pleased to meet you! My name's Lexie Little-Guy. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... New experiences? New treats? New places! Yes, please!
  • Purity 14%
  • Age 41 months
  • Racing Exp 0
  • St. Bernard 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAACCCTCATGATGACGATGATGATACACC
T
C
A
G
A
A
C
C
C
T
C
A
T
G
A
T
G
A
C
G
A
T
G
A
T
G
A
T
A
C
A
C
C
Genes: 72L7BB9BBJK

Composition

St. Bernard
36%
German Shepard
18%
Pug
9%
Grey Wolf
9%
French Bulldog
9%
Border Collie
9%
Maltese
9%

Current Energy

Vitality +7 points
Lunar Effect +6 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Grey Wolf
Front Legs German Shepard
Head St. Bernard
Ears St. Bernard
Snout French Bulldog
Mouth St. Bernard
Nose St. Bernard
Eyes Border Collie
Color Maltese