Binky Boone Crypto Dog - Mix of Corgi, Pug, Pitbull terrier, Rottweiler, Shiba Inu, Maltese, Labrador and Golder Retriever

Achievements

None
Binky Boone
Hello there, my name is Binky Boone. I've been known to run with bad dogs. Hope you like the smell of wet fur, because I'll jump into any water I see! I really enjoy heavy petting. Power outages and computer viruses scare me!
  • Purity 4%
  • Age 41 months
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGTAAGCACCCCAAGAGAATCCGAAAGCTCC
C
A
C
G
T
A
A
G
C
A
C
C
C
C
A
A
G
A
G
A
A
T
C
C
G
A
A
A
G
C
T
C
C
Genes: HEOK582N2ON

Composition

Corgi
18%
Pug
18%
Pitbull terrier
18%
Rottweiler
9%
Shiba Inu
9%
Maltese
9%
Labrador
9%
Golder Retriever
9%

Current Energy

Vitality -55 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Shiba Inu
Legs Corgi
Front Legs Maltese
Head Labrador
Ears Golder Retriever
Snout Pug
Mouth Pitbull terrier
Nose Pug
Eyes Corgi
Color Pitbull terrier